-
br Descriptive statistics br p respectively but health liter
2020-07-29
Descriptive statistics. β = 0.169, p (H2). Fig. 3 shows the path from OHIS to health literacy to colonoscopy uptake, and testing the hypotheses revealed similar results compared to the previous model. Namely, OHIS was positively associated with health literacy (H1; β = 0.144, p .001),
-
br DSBs result in H AX phosphorylation by ATM at
2020-07-08
DSBs result in H2AX phosphorylation by ATM at ser-139, which subsequently recruits the DNA repair proteins like BRCA1, RAD50 and RAD51 to the lesion sites. AIF treatment increased γ-H2AX phosphor-ylation levels and the formation of γ-H2AX foci, indicating that AIF induced DNA damage in the CRC cel
-
br Introduction br Benzene C H is a Volatile Organic
2020-07-06
1. Introduction Benzene (C6H6) is a Volatile Organic Compound (VOC) famous for its carcinogenic toxicity. In Europe, various publications have demon-strated the adverse health effects induced by the exposure of humans to atmospheric levels of benzene. Bentayeb et al. (2015) analyzed the associat
-
Imipenem br HK deficient in AKT overexpressing cell lines OV
2020-07-06
2.5. HK2-deficient in AKT2 overexpressing cell lines (OV AKT2 hk2) Based on the successful construction of AKT2 overexpressing colon cancer cells, the CRISPR/CAS9 system was used to knock out the hk2 gene. A single guide RNA (sgRNA: ACTGGTCAACCTTCTGCACT) tar-geting HK2 was designed using the on
-
br Elsevier Ltd BASO The Association for Cancer Surgery and
2020-03-24
0748-7983/© 2019 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved. Please cite this article as: Tapper J et al., Acute primary testicular failure due to radiotherapy increases risk of severe postoperative adverse events
-
br The combination of the gene model
2020-03-24
The combination of the 8-gene model and urinary o-Phenanthroline results does not significantly improve the diagnostic performance of the 8-gene classifier alone, neither in the training set (AUC = 0.903) nor in the testing set (AUC = 0.825) (Fig S1). DISCUSSION Patients with NMIBC are subm
-
br S M Akula et al Advances in Biological
2020-03-24
S.M. Akula, et al. Advances in Biological Regulation xxx (xxxx) xxxx Fig. 11. Effects of the NAX014 and NAX035 Compounds on the Proliferation and IC50s of MIA-PaCa-2 + pLXSN (Adh.) and MIA-PaCa-2 + WT-TP53 (Adh.) Cells in the Absence and Presence of 250 nM Metformin. Panel A) MTT analysis of MIA
-
br The secondary objective was to compare the IOUS assessmen
2019-11-11
The secondary objective was to compare the IOUS assessment with the pathologic assessment, including the radicality of the resection. The tertiary objective was to evaluate the assessment of vascular involvement; therefore, both the preoperative imaging results and the IOUS assessment of vascul
-
br HC is rich in polyphenols and also
2019-11-09
HC9 is rich in polyphenols and also contains flavonoids, phenols, saponins, alkaloids, tannins and Solasodine (Suryavanshi et al., 2014). Due to their chemopreventive properties, polyphenols can modulate the process of carcinogenesis either towards protective or therapeutic side depending upon ei
-
predictors of time to TR
2019-10-15
predictors of time to TR after ADT based on the International Journal of Radiation Oncology Biology Physics Table 1 Patient characteristics stratified by STADT and LTADT administration All patients Characteristic N % Median Range Clinical T stage Pathologic T
-
br Fidler IJ Gersten DM Hart IR The biology of
2019-10-15
[30] Fidler IJ, Gersten DM, Hart IR. The biology of cancer invasion and metastasis. Adv Cancer Res 1978;28:149–250. [31] Yuichi N, Tatsuya A, Kazuhiko K, Akihiko T, Yasuhisa K. Histologic features of venous invasion, expression of vascular endothelial growth factor and matrix me-talloproteinase-2
-
br Materials and methods br Chemicals and
2019-10-14
2. Materials and methods 2.1. Chemicals and reagents Isoquercitrin and isorhamnetin-3-o-β-glucopyranoside were pur-chased from KOC Biotechnology (Daejeon, Republic of Korea), and (+)-praeruptorin A, B, and E were supplied by ChemFaces (Wuhan, Hubei, China). The purity of the five authenti
-
br It is common to have some genes
2019-10-14
It is common to have some genes with missing Norfloxacin val-ues in most of the gene expression datasets. These genes should play no role in building the final classifier, and so, they should be excluded. The same exclusion process can be applied to ex-clude the CpG sites with missing values f
-
br C and D Immuno uorescence analysis
2019-10-14
(C and D) Immunoßuorescence analysis of Celsr1 (C) and Celsr2 (D) in EpCAM+ stem (CD133+) and non-stem (CD133-) primary tumor KX2-391 isolated from KPf/fC mice. Three frames were analyzed per slide, and the frequency of Celsr1-high or Celsr2-high cells determined, scale = 25um. (E) KPf/fC cell
-
br In the present study we use the AHP
2019-10-10
In the present study, we use the AHP method to determine the weights of the related criteria and subcriteria. In the AHP lit-erature, this method is used to pairwise compare and order the treatment alternatives. However, our approach differs from the traditional AHP method because we develop a pa